Society of University SurgeonsEndothelial selectin blockade attenuates lung permeability of experimental acid aspiration*,**
Section snippets
Description of recombinant proteins
rPSGL-Ig fusion protein (Genetics Institute, Cambridge, Mass) was derived from pED.47.Fc, a recombinant soluble form of PSGL-1 fused to human IgG1.15 Polymerase chain reaction was performed on the Fc portion of this plasmid by using 5′ primer: TAAATAGCGGCCGCACACATGCC-CACCGTGCCCAGCACCTGAAGCCCTGGGGGCACCGTCAGTCTTCCTC and 3′ primer: GCATGTTGCACCGAGGCCCCAGAATCA. The polymerase chain reaction product was digested with the restriction enzymes Not I and Kpn I and ligated to the large fragment of
Results
Acid aspiration in mice (n = 19) led to a marked rise in PI, 0.071 ± 0.008, compared with saline aspirated sham animals (n = 10), PI 0.007 ± 0.001 (P <.05, Fig 1).
Discussion
This study examines the role of PMN-endothelial selectin adhesion mechanisms in mediating acid aspiration lung injury. Neutropenic mice had a 63% reduction in lung injury after acid aspiration. This is similar to previous reports including other animal species.7, 8, 9, 10, 11 Prior work from this laboratory has shown that experimental lavage with leukotriene B4 into the airways of rats induced the synthesis of local tumor necrosis factor–α that in turn led to PMN diapedesis.11 The importance of
Acknowledgements
We thank Mr Gray Shaw of Genetics Institute, Cambridge, Mass, for the generous donation of rPSGL-Ig and m20ek.Fc used in the experiments.
References (23)
- et al.
Clinical predictors of adult respiratory distress syndrome
Am J Surg
(1982) - et al.
Mouse P-selectin glycoprotein ligand-1: molecular cloning, chromosomal localization, and expression of a functional P-selectin receptor
Blood
(1996) Traffic signals for lymphocyte recirculation and leukocyte emigration: the multistep paradigm
Cell
(1994)- et al.
Expression cloning of a functional glycoprotein ligand for P-selectin
Cell
(1993) - et al.
Potential risks and preventative measure for pulmonary aspiration: new concepts in preventative fasting guidelines
Anesth Analg
(1993) - et al.
Aspiration during anesthesia: a computer-aided study of 185,358 anesthetics
Acta Anaesthesiol Scand
(1986) - et al.
Adult respiratory distress syndrome: risk with common predispositions
Ann Intern Med
(1983) - et al.
The pathophysiology of aspiration pneumonitis
Surgery
(1966) - et al.
Acute acid aspiration lung injury in the rat: biphasic pathogenesis
Anesth Analg
(1989) - et al.
Experimental murine acid aspiration injury is mediated by neutrophils and the alternative complement pathway
J Appl Physiol
(1997)
Membrane attack complex of complement and neutrophils mediate the injury of acid aspiration
J Appl Physiol
Cited by (0)
- *
Supported in part by the National Institutes of Health grants GM-52585, GM-35141-09, GM-24891-18, The Brigham Surgical Group, Inc; and The Trauma Research Foundation.
- **
Reprint requests: Herbert B. Hechtman, MD, Brigham and Women's Hospital, 75 Francis Street, Boston, MA 02115.