Table 1

Sequences of DNA oligos for cloning, mutation and 3′-Dumbbell-PCR

Asc 3′UTR forwardTGCTCTAGAGCCAGTGTCCCTGCTCAGAGTA
Asc 3′UTR reverseGAAAAAAGCGGCCGCCTTTGCACTAGAATGGAGAAGC
Nlrp3 3′UTR forwardTGCTCTAGAGAAGCAGGACCACCAGGTGCCT
Nlrp3 3′UTR reverseGAAAAAAGCGGCCGCAACAATGTAGCTGAGAGGCTGC
Asc 3′UTR-mut-FATGTCCTTTGTGATGTGCTTTGTTCCATCC
Asc 3′UTR-mut-RCTTGTCTTGGCTGGTGGTCTCTGCACGA
Nlrp3 3′UTR-mut-FGTTTTGACTGCATCCCGCATAAGGAGCTGC
Nlrp3 3′UTR-mut-RAGGAAGACAAGACTGAAGGTATGGGCAA
Adenylated (3′-AAA) miR-223
 AdapterPhos/CTCAGTGCAGGGTCCGAGGTATTCGCACTGAGTTTTGG
 Primer-FGCGCTGTCAGTTTGTCAAATACCC
 Primer-RCGAATACCTCGGACC
 Probe6-FAM/CAAAACTCA/ZEN/GTG/IABkFQ
Uridylated (3′-UUU) miR-223
 AdapterPhos/CTCAGTGCAGGGTCCGAGGTATTCGCACTGAGAAATGG
 Primer-FGCGCTGTCAGTTTGTCAAATACCC
 Primer-RCGAATACCTCGGACC
 Probe6-FAM/CATTTCTCA/ZEN/GTG/IABkFQ
Adenylated(3′AAA) miR-142
 AdapterPhos/CTCAGTGCAGGGTCCGAGGTATTCGCACTGAGTTTTCC
 Primer-FGCGCTGTAGTGTTTCCTACTTTATG
 Primer-RCGAATACCTCGGACC
 Probe6-FAM/GAAAACTCA/ZEN/GTG/IABkFQ
Uridylated (3′-UUU) miR-142
 AdapterPhos/CTCAGTGCAGGGTCCGAGGTATTCGCACTGAGAAATCC
 Primer-FGCGCTGTAGTGTTTCCTACTTTATG
 Primer-RCGAATACCTCGGACC
 Probe6-FAM/GATTTCTCA/ZEN/GTG/IABkFQ
  • 3′-AAA, 3′ end adenylated; UTR, untranslated region; 3′-UUU, 3′ end uridylated.