Table 1

Mouse and human primer sequences for quantitative PCR analysis

PrimersForwardReverse
Mouse Gapdh GTGGAGTCATACTGGAACATGTAGAATGGTGAAGGTCGGTGTG
Mouse Ppargc1a CCCTGCCATTGT TAAGACTGCTGCTGTTCCTGT TTT
Human GAPDH GGAAGGGCTCATGACCACAGACA GTC TTC TGG GTG GCA GTG
Human PPARCG1A CTG TGTCACCACCCAAATCCTTATTGTGTCGAGAAAAGGACCTTG A
Human ACTA2 GTGAAGAAGAGGACAGCACTGCCCATTCCCACCATCACC
Human COL1A1 AAGGGACACAGAGGTTTCAGTGGCAGCACCAGTAGCACCATCATTTC
Human FN1 TGTCAGTCAAAGCAAGCCCGTTAGGACGCTCATAAGTGTCACCC
Human CTGF GTCCAGCACGAGGCTCATCGCCTTCGTGGTCCTC
Human CDKN2A GGGTTTTCGTGGTTCACATTCCTAGACGCTGGCTCCTCAGTA
Human GLB1 CCA CAG CCT GGG GTC TAT AACTGA CCA ACA GGT TCG CTA GAG
Human MT-ATP6TAGCCATACACAACACTAAAGGACGAGGGCATTTTTAATCTTAGAGCGAAA
Human PLIN2 TTGCAGTTGCCAATACCTATGCCCAGTCACAGTAGTCGTCACA
Human PPARG TGGAATTAGATGACAGCGACTTGGCTGGAGCAGCTTGGCAAACA