Table 1

Primers used for discovery and genotyping of polymorphisms within the interferon-γ receptor-1 (IFNGR1) gene

RegionPrimer namePrimer sequence (5′ to 3′)PCR product (bp)
PromoterIFNGR1-PPaCAAGGTGAAAAGTGCCATGA588
PromoterIFNGR1-PPbCACCCCATTCTGCAATTCTT
Exon 1IFNGR1-E1gGTAGCAGCATGGCTCTCCTC107
Exon 1IFNGR1-E1hGCGAACGACGGTACCTGA
Exon 2IFNGR1-E2uTATCTGGGCAATGTGGCATC301
Exon 2IFNGR1-E2dACGTGGGAAGGCTGATGAA
Exon 3IFNGR1-E3uTTCTACCGCTTTGTGCTGTG498
Exon 3IFNGR1-E3dATTTCCTTTGAGTGCCATGC
Exon 4IFNGR1-E4uTGTTTATTAAGGACCCCGAGA471
Exon 4IFNGR1-E4dTGATCTGTGAGTCTTGCTTGAA
Exon 5IFNGR1-E5uTGCATAGTATCGTGCTGTGTTG502
Exon 5IFNGR1-E5dGGAATGGAACTAATGCAAATGA
Exon 6IFNGR1-E6uGCTGGGAAGAACCATATTGC503
Exon 6IFNGR1-E6dTGCTGCACAGCAAAAGACA
Exon 7IFNGR1-E7uGCCATTTGGTGGTCCATTAC1461
Exon 7IFNGR1-E7dTGTTCTGCACACTGGGTGTT
Exon 7IFNGR1-E7iCAAATAATAAAGGTGAAATAAAInternal
Exon 7IFNGR1-E7i2CAGTAACGGAACAGTATCCInternal