Table 1

 Sequences of the TaqMan primers and probes used in the study

GeneSequence (5′ to 3′)Reference
All of the probes carried a 5′ FAM (6-carboxy-fluorescein) reporter dye and a 3′ TAMRA (6-carboxy-tetramethyl rhodamine) quencher dye.
NOS2 forwardACCCTGAGCTCTTCGAAATCCDesigned using primer express
NOS2 reverseTTAGCTCCAGTTCCCGAAACC
NOS2 probeTGGCCATGGAACATCCCAAATACGAG
NOS3 forwardGTGGCTGTCTGCATGGACCT15
NOS3 reverseCCACGATGGTGACTTTGGCT
NOS3 probeAGTGGAAATCAACGTGGCCGTGCT
NOS1 forwardCAGTGGTCCAAGCTGCAGGTA16
NOS1 reverseGGTGGCATACTTGACATGGTTACA
NOS1 probeTCGATGCCCGTGACTGCACCAC