Table 1

PCR primers and conditions used to amplify the regions of interest for further analysis. The expected fragment lengths are also indicated

PolymorphismPrimersConditionsFragment length (bp)
Promoter –367Forward60°C annealing; 30 cycles740
5′ CCTCTGCCTCGAGACCTCAAGCC 3′
Reverse
5′ CCGTCTGCAGACGCTCGAAC 3′
Promoter –47 Arg19→CysForward68°C annealing; 34 cycles1031
5′ CTTCGCGGCTGCCGGCGTG 3′
Reverse
5′ GACATGGAAGCGGCCCTCAG 3′
Coding Arg16→GlyForward60°C annealing; 36 cycles234
5′ CCCAGCCAGTGCGCTTACCT 3′
Coding Gln27→GluReverse
5′ CCGTCTGCAGACGCTCGAAC 3′